Expression einer funktionellen rekombinanten Glykosyltransferase in Escherichia coli

148  Download (0)

Full text

(1)

Expression einer funktionellen rekombinanten

Glykosyltransferase in Escherichia coli

Dissertation

zur Erlangung des Doktorgrades Dr. rer. nat. der Fakultät für

Naturwissenschaften der Universität Ulm

vorgelegt von

Jennifer Lauber

aus Friedrichshafen

2015

(2)

Die vorliegende Arbeit wurde im Institut für Angewandte Biotechnologie der Hochschule Biberach unter der Leitung von Frau Prof. Dr. Sabine Gaisser durchgeführt.

Amtierender Dekan: Prof. Dr. Joachim Ankerhold

Erstgutachter: Prof. Dr. Sabine Gaisser

Zweitgutachter: Prof. Dr. Peter Dürre

(3)

Die Arbeit wurde durch ein Promotionsstipendium nach dem Landesgraduiertenförderungsgesetzt (LGFG) des Landes Baden-Württemberg finanziert und im Rahmen des kooperativen Promotionskollegs (KPK) „Pharmazeutische Biotechnologie“ der Universität Ulm und der Hochschule Biberach durchgeführt.

Teile dieser Dissertation wurden bereits in folgendem Artikel publiziert:

Lauber J, Handrick R, Leptihn S, Dürre P, Gaisser S. (2015). Expression of the functional

(4)

"Das Maß der Hochachtung für eine Leistung richtet sich zu Recht nach den bei dem Unternehmen überwundenen Fehlschlägen."

(5)

Inhaltsverzeichnis

INHALTSVERZEICHNIS ... I ERLÄUTERUNGEN ...III

1. EINLEITUNG ... 1

2. MATERIAL UND METHODEN ... 6

2.1.CHEMIKALIEN UND ENZYME ... 6

2.1.1. Chemikalien ... 6

2.1.2. Spezielle Enzyme und Chemikalien ... 6

2.1.3. Kits ... 7

2.2.BAKTERIENSTÄMME,PLASMIDE,OLIGONUKLEOTIDE UND ANTIKÖRPER ... 8

2.3.ZELLKULTIVIERUNG ...13

2.3.1. Nährmedien ...13

2.3.2. Medienzusätze ...15

2.3.3. Stammhaltung ...15

2.3.4. Anzuchtbedingungen ...15

2.3.5. Bestimmung der Optischen Dichte ...16

2.4.ARBEITEN MIT NUKLEINSÄUREN ...16

2.4.1. Vorbereitung von Geräten und Lösungen ...16

2.4.2. DNA-Präparationen ...16

2.4.3. DNA-Konzentrationsbestimmung ...17

2.4.4. Verdau von DNA mit Restriktionsenzymen ...17

2.4.5. Dephosphorylierung von DNA-Fragmenten ...17

2.4.6. Gelelektrophoretische Auftrennung von DNA-Fragmenten ...18

2.4.7. Gelextraktion ...19

2.4.8. Ligation ...19

2.4.9. Kontrollverdau ...21

2.4.10. DNA-Sequenzierung ...21

2.5.HERSTELLUNG UND TRANSFORMATION ELEKTROKOMPETENTER E. COLI-ZELLEN ...21

2.6.EXPRESSION DER HISDAPGALNACT2-GLYKOSYLTRANSFERASE IN E. COLI-STÄMMEN ...22

2.6.1. Expression in E. coli OrigamiTM 2(DE3)pLysS ...23

2.6.2. Expressionversuche in E. coli SHuffle® T7 ...23

2.7.PROTEINISOLIERUNG UND PROTEINANALYSE ...25

2.7.1. Herstellung von Zellextrakten ...25

2.7.2. Metallchelatchromatographie (engl. immobilized metal affinity chromatography, IMAC) ...25

2.7.3. Konzentrierung von Proteinlösungen mittels Ultrafiltration ...28

2.7.4. Diafiltration der Proteinlösungen ...28

2.7.5. Bestimmung der Proteinkonzentration mittels BCA-Assay ...28

2.7.6. Natriumdodecylsulfat-Polyacrylamidgelelektrophorese (SDS-PAGE) ...30

2.7.8. Western Blot (semi-dry) ...36

2.7.9. Größenausschlusschromatographie mit Mehrwinkelstreudetektor (engl. size exclusion chromatography with multi-angle static light scattering, SEC-MALS) ...38

2.7.10. CD-Spektroskopie ...38

2.7.11. Glykosyltransferase Aktivitätsassay ...39

(6)

2.7.13. Größenausschluss- und Hochleistungsflüssigkeitschromatographie (engl. size

exclusion chromatography-high-performance liquid chromatography, SEC-HPLC) ...41

2.7.14. Proteolytische Spaltung von HisDapGalNAcT2 zum Nachweis potentieller Disulfidbrücken ...42

2.7.15. Behandlung der HisDapGalNAcT2-Einschlusskörperchen mit N-Lauroylsarcosin ...44

3. ERGEBNISSE ...45

3.1.KONSTRUKTION VON EXPRESSIONSPLASMIDEN ...45

3.1.1. Konstruktion des Expressionsplasmids pET23d(+)::HisDapGalNAcT2 ...45

3.1.2. Konstruktion des GalNAcT2 Expressionsplasmids pET23a(+)::GalNAcT2 ...47

3.1.3. Konstruktion der Genkassette pET23a(+)::HisDapGalNAcT2::gcsf6xHis ...48

3.2.EXPRESSION VON HISDAPGALNACT2 IN E. COLI EXPRESSIONSSYSTEMEN ...52

3.2.1. Expression in E. coli OrigamiTM 2(DE3)pLysS ...52

3.2.2. Expression in E. coli SHuffle® T7 ...55

3.3.PROTEINAUFREINIGUNG ...62

3.3.1. Analytische Reinigung und Optimierung der Reinigungsbedingungen ...62

3.3.2. Präparative Reinigung von HisDapGalNAcT2-Glykosyltransferase...63

3.4.ANALYSE DES AUFGEREINIGTEN HISDAPGALNACT2PROTEINS ...65

3.4.1. SEC-MALS ...65

3.4.2. CD-Spektroskopie ...66

3.4.3. Untersuchung der enzymatischen Aktivität von HisDapGalNAcT2 ...67

3.4.4. Proteolytische Spaltung von HisDapGalNAcT2 ...75

3.4.5. Untersuchung der Stabilität der HisDapGalNAcT2- und rhGalNAcT2-Glykosyltransferasen ...80

3.4.6. Untersuchung der unlöslichen HisDapGalNAcT2-Fraktion auf die Anwesenheit funktioneller Glykosyltransferase ...81

3.5.EXPRESSION DER GENKASSETTE PET23A(+)::HISDAPGALNACT2::GCSF6XHIS IN 24-DEEPWELL-PLATTEN ...82

4. DISKUSSION ...85

4.1.E. COLI ALS PRODUKTIONSORGANISMUS ...85

4.2.ENTWICKLUNG EINES E. COLI-BASIERTEN MODELLSYSTEMS ZUR GLYKOSYLIERUNG VON BIOPHARMAZEUTISCH RELEVANTEN PRODUKTEN ...87

4.2.1. Analyse der aufgereinigten HisDapGalNAcT2 ...97

4.2.2. Expression der Genkassette pET23a(+)::HisDapGalNAcT2::gcsf6xHis ... 103

4.3.GLYKOENGINEERING ... 105 5. A. ZUSAMMENFASSUNG ... 110 5. B. SUMMARY ... 111 6. LITERATURVERZEICHNIS ... 112 7. ANHANG ... 132 8. PUBLIKATIONEN ... 133

(7)

Erläuterungen

Die in Klammern angegebenen Literaturzitate im Text dieser Arbeit beziehen sich auf die im Literaturverzeichnis aufgeführten Artikel, Bücher und Webseiten. Die CD-Messungen wurden gemeinsam mit Dr. Sebastian Leptihn am Institut für Mikrobiologie und Molekularbiologie an der Universität Hohenheim durchgeführt.

In dieser Arbeit wurden die im Folgenden aufgeführten Abkürzungen, Einheiten und Einheitspräfixe verwendet.

Abkürzungen (alphabetisch)

#

A

Nummer

AA „amino acid“, Aminosäure

ABL2 „Abelson tyrosine-kinase 2“, Tyrosin-Proteinkinase Adh Alkoholdehydrogenase ApR Ampicillinresistenz AphC* Thiolreduktase AppA Phytase APS Ammoniumpersulfat ATP Adenosintriphosphat B BCA Bicinchoninsäure

BHK „baby hamster kidney“, Babyhamster-Nierenzellen

bp Basenpaare

BPTI „bovine pancreatic trypsin inhibitor“, Rinderpankrease-Trypsininhibitor

BSA „bovine serum albumin“, Rinderserumalbumin

C

CamR Chloramphenicolresistenz

CD Circulardichroismus

CHO „chinese hamster ovary“, chinesische Hamster-Ovarien

CHY1 Chymotrypsinogen

CMP „cytidine monophosphat sialic acid”, Cytidinmonophosphat-Sialinsäure

CMV Cytomegalovirus Promotor

CREB-1 “cAMP responsive element-binding protein”, Transkriptionsfaktor

Cu2+ Kupferionen

(8)

D DNA Desoxyribonukleinsäure DF Durchfluss DHFR Dihydrofolatreduktase DTT Dithiothreitol E

E. coli Escherichia coli

EDTA Ethylendiamintetraessigsäure

EF Endotoxinfrei

EL Eluat-Fraktion

EPO Erythropoetin

Erv1p Sulfhydryloxidase Erv1p ESI Elektronensprayionisation

et al. „et alii“, und andere

F

FAD Flavin-Adenin-Dinukleotid

FIS „factor for inversion stimulation protein“, Genregulatorprotein

FWD „forward“, Vorwärts Primer

G

GalNAc N-Acetylgalactosamin

GalNAcT2 Glykosyltransferase-T2, N-Acetylgalactosaminyltransferase 2

G-CSF „granulocyte-colony stimulating factor“, Granulocyten-Kolonie stimulierender Faktor

GFP Grün fluoreszierendes Protein

GmbH Gesellschaft mit beschränkter Haftung

GM-CSF “granulocyte-macrophage colony-stimulating factor”, Granulocyten-Makrophagen Kolonie-stimulierender Faktor

gor Glutathionreduktase

Grx1 Glutathion

H

HAE hereditäres Angioödem

HCCA „α-cyano-4-hydroxycinnamic acid“, α-Cyano-4-hydroxyzimtsäure hCG- β die β-Kette des humanen Choriongonadotropin

HCl Salzsäure

(9)

H2O-EF endotoxinfreies Wasser

HexNAc Monosaccharid N-Acetylgalactosamin

His7ΔN6TNFα verkürzte Form des Tumornekrosefaktors α mit N-terminalen Hexa-Histidintag H-NS „histone-like nucleosid-structuring protein“, Nukleoid-assoziiertes

Genregulatorprotein

HPLC „high-performance liquid chromatography“, Hochleistungsflüssigkeitschromatographie HPV humane Papillomaviren

HRP „horse radish peroxidase“, Meerrettichperoxidase

I

IB „inclusion bodies“, Einschlusskörperchen

IFN-α2b Interferon-α 2b

IMAC „immobilized metal affinity chromatography“, Metallchelatchromatographie iNTPs „initiating nucleoside triphosphates“

IPTG Isopropyl-β-D-thiogalactopyranosid

IRES „internal ribosome entry site“, interne ribosomale Eintrittsstelle

K KanR Kanamycinresistenz L LB „lysogeny broth“ LF lösliche Fraktion M

MALDI-TOF-MS Matrix-unterstützte Laser-Desorption/Ionisation mit Flugzeitmassenspektrometer Detektion

MMDB „The Molecular Modelling Database“

MMP Magermilchpulver mod. modifiziert ms Millisekunden MS Massenspektrometrie N NaAc Natriumacetat NaCl Natriumchlorid NaHCO3 Natriumhydrogencarbonat NaOH Natriumhydroxid

(10)

Ni Nickel

NS0 murine Myelomzellen NTA Nitrilotriessigsäure

O

O-GalNAc O-linked α-N-Acetylgalactosamin O-GlcNAc O-linked β-N-Acetylglucosamin

OD Optische Dichte

OSM-Fragment „ovine submaxillary mucin“, Submaxillarmucin des Schafes

P

PAP prostataspezifische saure Phosphatase

P. pastoris Pichia pastoris

PBMC „peripheral blood mononuclear cells“, autologe mononukleäre Zellen des peripheren Blutes

PBS „phosphate buffered saline“, Phosphatgepufferte Salzlösung

PDB „Protein Data Bank“

PDI „protein disulfide isomerase“, Proteindisulfidisomerase

PEG Polyethylenglycol

PES Polyethersulfon

PF Partikuläre Fraktion PglB Oligosaccharyltransferase

PhoA „alkaline phosphatase“, alkalische Phosphatase ppGpp „guanosine 5‘-diphosphate 3‘-diphosphate“ PTM posttranslationale Modifikationen

PVDF Polyvinylidenfluorid

R

® „registered“, eingetragenes Warenzeichen

RBS Ribosomenbindestelle

RE Rohextrakt

REV „reverse“, Rückwärts Primer

rh „recombinant human“

rpm „rounds per minute“, Umdrehungen pro Minute

RT Raumtemperatur

S

SA „specific activity“, spezifische Aktivität

S. cerevisiae Saccharomyces cerevisiae

(11)

SDS Natriumdodecylsulfat

SDS-PAGE „sodium dodecyl polyacrylamide gel electrophoresis“, Natriumdodecylsulfat-Polyacrylamidgelelektrophorese

SEC-MALS „size exclusion chromatography with multi-angle static light scattering“, Größenausschlusschromatographie mit Mehrwinkelstreudetektor

ST3Gal-III „β-galactoside alpha-2,3-sialyltransferase 3”, Sialyltransferase ST3GAL3 ST6GalNAc-I „α-2,6-Sialyltransferase”, Sialyltransferase ST6GalNAc I

T

TAE Tris-Acetat-EDTA-Puffer

Taq-Polymerase thermostabile DNA-Polymerase des Bakteriums Thermus aquaticus

TB „terrific broth“

TBS Tris gepufferte Saline

TBST Tris gepufferte Saline mit Tween20

TbTIM Triosephosphatisomerase

TEMED Tetramethylethylendiamin

TGP Trenngelpuffer

TKpA „herpes simplex virus thymidine kinase polyadenylation signal“

„trademark“, Warenzeichen Tris Tris-aminomethan trxB Thioredoxinreduktase U UDP Uridin-Diphosphat UDP-GalNAc Uridin-5‘-Diphospho-N-Acetylgalactosamin UniProt „Universal Protein Resource“

UV Ultraviolett

V

V Volt

VMT vitreomakuläre Traktion

vtPA „tissue plasminogen activator“, gewebespezifischen Plasminogenaktivator

Einheiten

°C Grad Celsius

(12)

Bp Basenpaar

Da Dalton, atomare Masseneinheit

g Gramm

g mittlere Erdbeschleunigung, ca. 9,81 m/s2

h Stunden

l Liter

M molar, mol/l

min Minuten

mol Mol, (SI-Basiseinheit der Stoffmenge)

pH negativer dekadischer Logarithmus der H+-Konzentration

rpm „rounds per minute“, Umdrehungen pro Minute

U Unit (Enzymeinheit, gibt Aufschluss über die Aktivität)

V Volt

v/v „volume per volume“ (Volumen pro Volumen)

w/v “weight per volume” (Gewicht pro Volumen)

w/w “weight per weight” (Gewicht pro Gewicht)

Einheitenpräfixe

k Kilo 103 c Zenti 10-2 m Milli 10-3 µ Mikro 10-6 n Nano 10-9 p Piko 10-12

(13)

1. Einleitung

Rekombinant hergestellte therapeutische Proteine stellen einen wichtigen Anteil biotechnologisch produzierter Medikamente dar (Leader et al., 2008; Strohl und Knight, 2009). Bereits in den 1980er Jahren wurde der Begriff Biopharmazeutika eingeführt um speziell jene Produkte, die durch moderne molekularbiologische Methoden produziert wurden, von denen, die unter traditionellen biologischen Bedingungen hergestellt wurden, zu unterscheiden (Walsh, 2002). Seit 1982, mit der Einführung von rekombinant hergestelltem Humaninsulin, stieg die Anzahl und Diversität der auf dem Markt zugelassenen biopharmazeutisch hergestellten Produkte stetig an (Leader et al., 2008; Swartz, 2001). Bis Juli 2014 wurden von der Europäischen Union und den Vereinigten Staaten von Amerika insgesamt 246 biopharmazeutische Produkte zugelassen, von denen 212 Biopharmazeutika gegenwärtig vermarktet werden (Walsh, 2014). Eine graphische Übersicht über die bis Juli 2014 zugelassenen Biopharmazeutika zusammengefasst in die rekombinant hergestellten Produktkategorien Blutfaktoren, Thrombolytika und Antikoagulanzien, Hormone (Insulin, humanes Wachstumshormon u.a.), Wachstumsfaktoren (Erythropoetin, Kolonie stimulierende Faktoren u.a.), Interferone und Interleukine, Vakzine (Hepatitis B u.a.), monoklonale Antikörper-basierte Produkte und weitere rekombinant hergestellte Proteine (rekombinante Enzyme, Fusionsproteine und Gentherapie/Nukleinsäure basierte rekombinante Produkte) ist in Abbildung 1 A dargestellt (Walsh, 2014).

Abbildung 1: Darstellung der insgesamt 246 zugelassenen Biopharmazeutika (A) und der zur Produktion verwendeten Expressionssysteme (in Prozent) auf dem biopharmazeutischen Markt (B). Die graphischen Darstellungen (A und B) basieren auf von G. Walsh, 2014 publizierten Daten (Walsh, 2014)

(14)

Der Marktanteil der aufgeführten biopharmazeutischen Produkte erreichte für 2013 einen Wert von $ 140 Milliarden US Dollar (Walsh, 2014).

Für die Herstellung rekombinanter Proteine werden sowohl Bakterien-, Hefe-, Insekten- als auch Säugerzellen eingesetzt (Berlec und Strukelj, 2013; Demain und Vaishnav, 2009). Die am häufigsten verwendeten Expressionssysteme in der biopharmazeutischen Produktion sind in Abbildung 1 B dargestellt. Generell werden an industriell genutzte Expressionsplattformen zahlreiche Anforderungen gestellt. So sollten die zur Produktion eingesetzten Organismen ein schnelles Wachstum in Kulturmedien mit kostengünstiger Mediumzusammensetzung aufweisen (Baneyx, 1999; Demain und Vaishnav, 2009; Sørensen und Mortensen, 2005; Waegeman und Soetaert, 2011). Genetische Modifizierbarkeit sowie die Expression der Proteine in löslicher, aktiver Form stellen weitere erwünschte Eigenschaften industrieller Produzenten dar (Graumann und Premstaller, 2006; Huang et al., 2012; Sørensen und Mortensen, 2004). Die Wahl des geeigneten Expressionssystems basiert zudem auf dem Potenzial der Produktionszellen, weitere Proteinmodifikationen durchzuführen (Walsh, 2010b; Yin et al., 2007). Posttranslationale Modifikationen wie Glykosylierungen, Phosphorylierung und Disulfidbrückenbildung beeinflussen Aktivität und Stabilität der biopharmazeutischen Produkte (Waegeman und Soetaert, 2011; Walsh, 2014). Unter den posttranslationalen Modifikationen sind N- und O-Glykosylierungen (Abbildung 2) oftmals vertreten. Diese Glykolysierungsreaktionen werden durch spezifische Glykosyltransferasen katalysiert (Costa et al., 2014; Merritt et al., 2013; Nothaft und Szymanski, 2010; Walsh und Jefferis, 2006). Eine N-Glykosylierung erfolgt durch die kovalente Verbindung eines Zuckerrests an den Stickstoff der freien Amidgruppe der Aminosäure Asparagin (Abbildung 2 A) (Merritt et al., 2013).

Abbildung 2: Schematische Darstellung der N-glykosidischen Bindung zwischen N-Acetylglucosamin (schwarz) und der Aminosäure Asparagin (orange) (A) (Shi und Goudar, 2014, mod.) und der O-glykosidischen Bindung zwischen N-Acetylgalactosamin (schwarz) und der Aminosäure Serin (violett) (B) (Berg et al., 2013; Pratt et al., 2004, mod.).

(15)

N-Glykosylierungen stellen eine häufige posttranslationale Modifikation in Eukaryoten dar (Schwarz et al., 2010), es sind allerdings auch Beispiele für N-Glykosylierungsreaktionen in bakteriellen Vertretern bekannt (Costa et al., 2014; Cuccui und Wren, 2015). Besonders detailliert wurde der N-Glykan Biosyntheseweg des Proteobakteriums Campylobacter jejuni charakterisiert (Morrison und Imperiali, 2014; Nothaft und Szymanski, 2010; Schwarz et al., 2010). In C. jejuni werden Heptasaccharidketten an Lipidankern durch den Einsatz von mehreren Glykosyltransferasen gebildet. Der Transport der an Undecaprenylpyrophosphat gebundenen Zuckerkette ins Periplasma erfolgt durch die PglK Flippase (Nothaft und Szymanski, 2010; Schwarz et al., 2010). Im Periplasma wird der Transfer der Glykane an Akzeptorproteine durch die Oligosaccharidtransferase PglB katalysiert (Alaimo et al., 2006; Kelly et al., 2006; Nothaft und Szymanski, 2010; Schwarz et al., 2010). In Campylobacter wurden weitere Glykosylierungsmechanismen wie die Modifikation von Flagellenproteinen durch O-Glykosylierungen identifiziert (Nothaft und Szymanski, 2010). Weitere Beispiele für Bakterien mit O-glykosidischen Proteinglykosylierungsmechanismen sind unter den Vertretern der Gattungen Neisseria und Acinetobacter bekannt (Faridmoayer et al., 2008; Iwashkiw et al., 2012). Die O-Glykosylierung von mucinartigen Glykoproteinen wird in Tieren durch die kovalente Verknüpfung des Monosaccharids N-Acetylgalactosamin an die Hydroxylgruppe der Aminosäuren Serin oder Threonin ermöglicht (Abbildung 2 B, Bertozzi und Rabuka, 2009; Fritz et al., 2006; Hansen et al., 1995; Roth et al., 2012; White et al., 1995; Wildt und Gerngross, 2005). Im menschlichen Körper sind Mucine Bestandteil des Schleims, der als visköses Sekret eine Vielzahl an Glykoproteinen enthält und die Oberflächen von Schleimhäuten bedeckt (McGuckin et al., 2011).

Das Vorhandensein und die Zusammensetzung von spezifischen Glykosylierungsmustern üben einen Einfluss auf Eigenschaften wie Funktionalität, Faltung, Stabilität und Immunogenität des jeweiligen Glykoproteins aus (Costa et al., 2014; Hounsell et al., 1996; Merritt et al., 2013; Solá und Griebenow, 2009). Da der Anteil von Glykoproteinen an produzierten Biopharmazeutika bei 40 % liegt (Walsh, 2010a) werden generell für die Produktion von Glykoproteinen eukaryotische Zellsysteme, wie Chinesische Hamster-Ovarien- (engl. chinese hamster ovary, CHO), murine Myelom (NS0)- oder baby hamster

kidney (BHK)- Zelllinien verwendet (Walsh und Jefferis, 2006). Obwohl fast ein Drittel der

derzeitig zugelassenen rekombinant hergestellten therapeutischen Proteine in E. coli-Stämmen produziert werden (Huang et al., 2012; Rosano und Ceccarelli, 2014), ist die Anwendung von Bakterien-basierten Expressionssystemen durch das fehlende Einführen von posttranslationalen Modifikationen eingeschränkt (Kamionka, 2011; Skretas et al., 2009; Walsh, 2014). Dies führte zu einem Anstieg der eukaryotischen im Vergleich zu den prokaryotischen Expressionssystemen, da durch die Nutzung dieser Produktionsplattformen Produkte mit therapeutisch relevanten Glykoprofilen hergestellt werden können (Walsh, 2014). Bisher wurden E. coli-basierte Systeme zur Expression von nicht-glykosylierten

(16)

Proteinen wie Insulin, Somatropin (Wachstumshormone), rhIL-2 (Interleukin) oder Filgrastim (Granulozyten-Kolonie stimulierender Faktor) eingesetzt (Costa et al., 2014; Kamionka, 2011; Walsh, 2014).

Da E. coli als Expressionsstamm viele Vorteile bietet, stellt die Entwicklung von modifizierten Stämmen für die Expression von komplexen Biotherapeutika mit korrekter Proteinfaltung, Disulfidbrückenbildung und Glykosylierungsmodifikationen ein wichtiges Ziel dar (Merritt et

al., 2013). Optimierte E. coli-basierte Expressionssysteme könnten zu einer signifikanten

Reduzierung der Prozesszeit und Minderung der anfallenden Produktionskosten führen (Merritt et al., 2013; Walsh und Jefferis, 2006).

Erste Erfolge zur Herstellung glykosylierter Proteine in modifizierten E. coli-Stämmen wurden bereits erzielt (Cuccui und Wren, 2015; Ihssen et al., 2010; Merritt et al., 2013; Nothaft und Szymanski, 2010). So konnte die N-Glykosylierung der sequenzadaptierten humanen IgG-Fc CH2-Domäne und des Einzelkettenantikörpers „single-chain antibody“ F8 in optimierten E.

coli-Stämmen nachgewiesen werden, nachdem das modifizierte Glykosylierungsoperon pgl2

aus C. jejuni heterolog in E. coli exprimiert wurde (Schwarz et al., 2010). Ein weiterer Fortschritt wurde durch die Konstruktion eines optimierten E. coli–Stammes mit vier heterolog exprimierten Glykosyltransferasen aus Saccharomyces cerevisiae in Kombination mit der bakteriellen Oligosaccharyltransferase PglB aus C. jejuni erzielt. In diesem Stammhintergrund wurde die Glykosylierung von sequenzoptimierten Versionen der bovinen RNAse A, der humanen IgG1 Fc-Domäne und des plazentaren Wachstumshormons hGH-V in einem geringen Protzentsatz (< 1 %) nachgewiesen (Valderrama-Rincon et al., 2012).

Im Mittelpunkt dieser Arbeit steht die Entwicklung eines E. coli Stammes zur Expression einer aktiven humanen Glykosyltransferase. Die Bildung des funktionsfähigen Enzyms ist eine wesentliche Voraussetzung zur Etablierung eines zukünftigen Modellsystems in E. coli zur Herstellung rekombinanter, glykosylierter und biopharmazeutisch relevanter Produkte. Die erfolgreiche Produktion einer humanen Glykosyltransferase wurde bereits durch die Expression der Sialyltransferase ST6GalNAcI in optimierten E. coli-Stämmen gezeigt (Skretas et al., 2009). Die Aktivität des Enzyms wurde in einem Hochdurchsatz-Assay durch den Transfer einer Sialinsäure nachgewiesen, wobei als O-Glykosylierungssubstrat ein bovines submaxilläres Mucin eingesetzt wurde (Skretas et al., 2009).

Für die Entwicklung des E. coli-basierten Modellsystems wurde als zentrale Komponente die humane Glykosyltransferase UDP-GalNAc:Polypeptid N-Acetylgalactosaminyltransferase 2 [GalNT2, GeneID:2590, UniProtID:Q10471] im Rahmen dieser Arbeit eingesetzt. Zum Nachweis der Aktivität der GalNAcT2-Glykosyltransferase wurden bereits mehrere Peptid- und Proteinsubstrate getestet (Horynová et al., 2012; Röttger et al., 1998; Wandall et al., 1997). In dieser Arbeit wurden das synthetische Mucin Peptid-Derivat EA2 [GeneID:U03407] und der biopharmazeutisch relevante Granulozyten-Kolonie stimulierende Faktor (engl.

(17)

granulocyte-colony stimulating factor, G-CSF) [UniProtID:P09919] erfolgreich eingesetzt

(Albone et al., 1994; Fritz et al., 2006; Vanz et al., 2008).

Das Polypeptidhormon G-CSF gehört zur Klasse 1 der Zytokin-Superfamilie und fördert sowohl die Proliferation als auch die Differenzierung von neutrophilen Granulozyten (Aritomi

et al., 1999; Kubota et al., 1990; Vanz et al., 2008). Eine Medikation mit G-CSF kann die

Dauer einer Neutropenia bei Patienten, die sich einer zytotoxischen Chemotherapie unterzogen haben, reduzieren. Weiterhin wird G-CSF im Rahmen der Begleittherapie nach Knochenmarkstransplantationen eingesetzt (Gascon, 2012; Leader et al., 2008). Das Vorläuferprotein („precursor“) weist eine O-Glykosylierungsstelle an der Aminosäure Thr166 [UniProt:P09919], welche identisch mit Position Thr133 des gereiften Polypeptidhormons G-CSF ist, auf (DeFrees et al., 2006). Die O-Glykosylierung von G-G-CSFhat keinen Einfluss auf die Wirksamkeit des Biopharmazeutikas (Höglund, 1998). Es konnte gezeigt werden, dass die Anwesenheit einer O-glykosidischen Zuckerkette an Thr133 zur Verminderung der Polymerisation und somit zur Stabilität von G-CSF beiträgt (Oh-eda et al., 1990). Für die Produktion von rekombinant hergestelltem G-CSF werden CHO- und E. coli-basierte Zellsysteme eingesetzt (Hammerling et al., 1995; Oheda et al., 1988; Rotondaro et al., 1999). Das in CHO-Zellen hergestellte Glykoprotein wird als Lenograstim und die nicht-glykosylierte Version von G-CSF aus E. coli-Expressionsstämmen wird unter dem Namen Filgrastim™ vermarktet (Hammerling et al., 1995; Martin-Christin, 2001).

Im Rahmen dieser Arbeit wurde ein für die Expression in E. coli codonoptimiertes Genfragment, das die lösliche Form der humanen GalNAcT2 codiert, designt und in ein geeignetes T7-basiertes Expressionssystem kloniert. Die bereits im Detail untersuchten Komponenten des T7-Systems, einer Standardmethode zur Proteinproduktion in E. coli, stammen aus dem Phagen T7 (Chamberlin et al., 1970; Dunn und Studier, 1983; Moffatt et

al., 1984). Um die Produktion der GalNAcT2-Glykosyltransferase in löslicher Form zu

ermöglichen wurden unterschiedliche E. coli-Stämme und Kultivierungsbedingungen getestet. Für die gleichzeitige Expression der GalNAcT2-Glykosyltransferase und G-CSF als Glykosylierungssubstrat wurde eine Genkassette konstruiert. Ein weiterer wichtiger Bestandteil dieser Arbeit war die Analyse der Proteinstruktur der isolierten HisDapGalNAcT2-Glykosyltransferase sowie die Etablierung eines in vitro Aktivitätsassays. Die Glykosylierung des synthetischen Mucin Peptid-Derivats EA2 und des Proteinsubstrats G-CSF wurde durch massenspektrometrische Analysen untersucht.

(18)

2. Material und Methoden

2.1. Chemikalien und Enzyme

2.1.1. Chemikalien

Die in dieser Arbeit verwendeten Chemikalien wurden von den Firmen

Applichem GmbH Darmstadt, Deutschland

Carl Roth GmbH & Co. KG Karlsruhe, Deutschland

Sigma-Aldrich Chemie GmbH Taufkirchen bei München, Deutschland bezogen.

Antibiotika:

Ampicillin-Natriumsalz Carl Roth GmbH & Co. KG, Karlsruhe Chloramphenicol Carl Roth GmbH & Co. KG, Karlsruhe Kanamycinsulfat Carl Roth GmbH & Co. KG, Karlsruhe

2.1.2. Spezielle Enzyme und Chemikalien

Restriktionsendonukleasen:

NdeI Fermentas, Thermo Fisher Scientific Inc., St. Leon-Rot

SpeI Fermentas, Thermo Fisher Scientific Inc., St. Leon-Rot

XbaI Fermentas, Thermo Fisher Scientific Inc., St. Leon-Rot

XhoI Fermentas, Thermo Fisher Scientific Inc., St. Leon-Rot

Enzyme

FastAP

Thermosensitive Alkaline Phosphatase

(19)

T4-DNA-Ligase Fermentas, Thermo Fisher Scientific Inc., St. Leon-Rot

Taq Polymerase Fermentas, Thermo Fisher Scientific Inc., St. Leon-Rot

Proteasen

Asp-N Pierce, Thermo Scientific Inc. USA

SG Chymotrypsin G-Biosciences®, VWR International GmbH, Darmstadt

LysC Pierce, Thermo Scientific Inc. USA

Proteine / Peptide

rhGalNAcT2 R&D Systems GmbH, Wiesbaden-Nordenstadt

Filgrastim™ Neupogen®, Amgen Inc., München

EA2 Eurogentec SA, AnaSpec Inc., Belgien

Spaltbares Detergens

RapiGest™ SF

Surfactant

Waters Corporation, Milford, USA

2.1.3. Kits

Für die Isolierung und Aufreinigung von Plasmid-DNA wurden folgende Kits verwendet.

Roti®-Prep Plasmid Mini, Carl Roth GmbH & Co. KG, Karlsruhe QIAGEN Plasmid Midi Kit, Qiagen, Hilden

Zur Extraktion von linearisierter Plasmid-DNA aus Agarosegelen wurde das „QIA-quick® Gel Extraktion Kit“ von Qiagen, Hilden verwendet.

Die Äktivitätsbestimmung der Glykosyltransferase wurde mit dem „Glycosyltransferase Activity Kit“ von R&D Systems GmbH, Wiesbaden-Nordenstadt bestimmt.

(20)

Die Glucosekonzentration wurden mit dem Konelab™ System Glucose-Reagenzien-Kit (981304, Thermo Fisher Scientific Inc. Waltham, USA,) und die Acetatkonzentration mit dem enzymatischen BioAnalysis Essigsäure Kit (R-Biopharm AG, Darmstadt, Deutschland) mit Hilfe des Konelab™ Arena 20XT (Thermo Fisher Scientific Inc. Waltham, USA,) bestimmt.

2.2. Bakterienstämme, Plasmide, Oligonukleotide und Antikörper

Die in dieser Arbeit verwendeten Bakterienstämme sind in der nachfolgenden Tabelle 1 aufgeführt.

Tabelle 1: Bakterienstämme

Bakterienstamm Geno- oder Phänotyp Herkunft/Referenz

NovaBlue endA1 hsdR17 (rK12– mK12+) supE44 thi-1

recA1 gyrA96 relA1 lac F′[proA+B+ lacIqZΔM15::Tn10] (TetR)

Novagen, Merck Millipore, Deutschland

OrigamiTM 2(DE3)pLysS Δ(ara-leu)7697 ΔlacX74 ΔphoA PvuII phoR araD139 ahpC galE galK rpsL

F′[lac+

lacIq pro] (DE3) gor522::Tn10 trxB

pLysS (CamR, StrR, TetR)

Novagen, Merck Millipore, Deutschland

SHuffle® T7 Express fhuA2 lacZ::T7 gene1 [lon] ompT ahpC gal λatt::pNEB3-r1-cDsbC (SpecR, lacIq)

ΔtrxB sulA11 R(mcr-73::miniTn10--TetS)2 [dcm] R(zgb-210::Tn10 --TetS) endA1

Δgor ∆(mcrC-mrr)114::IS10

C3029H, New England Biolabs, Deutschland

SHuffle® T7 F´ lac, pro, lacIQ / Δ(ara-leu)7697 araD139 fhuA2 lacZ::T7 gene1 Δ(phoA)PvuII phoR ahpC* galE (or U) galK λatt::pNEB3-r1-cDsbC (SpecR, lacIq) ΔtrxB rpsL150(StrR) Δgor Δ(malF)3

C3026H, New England Biolabs, Deutschland

(21)

Die für die beschriebene Arbeit verwendeten Plasmide sind in Tabelle 2 aufgelistet.

Tabelle 2: Plasmide

Plasmid Größe

(kBp)

Merkmale Herkunft/Referenz

pET23d(+) 3,6 ColE1 ori, f1 ori, bla

(ApR), T7 Promotor

Novagen, Merck Millipore, Deutschland pET23d(+)::HisDapGCSF 4,1 ColE1 ori, f1 ori, bla

(ApR), T7 Promotor, Diaminopeptidase spaltbarer HisDap-Tag Institut für Angewandte Biotechnologie, Hochschule Biberach (Boubeva et al., 2012)

pMK-RQ 4,0 ColE1 ori, KanR,

Gen: codonoptimierte GalNAcT2 für Expression in E. coli GeneArt® Gene Synthesis, Life Technologies GmbH, Deutschland, diese Arbeit pMJS9 8,2 modifizierter pLysBAD, p15A (ori), CamR, Ara Promotor, Gene: codonoptimierte Sulfhydryloxidase Erv1p aus Saccharomyces cerevisiae und codonoptimierte humane Proteindisulfid-isomerase (PDI) Zur Verfügung gestellt von Prof. Dr. Lloyd W. Ruddock, University of Oulu, Finnland (Nguyen et al., 2011)

(22)

Fortsetzung von Tabelle 2

Plasmid Größe

(kBp)

Merkmale Herkunft/Referenz

pMJS205 7,1 modifizierter pLysS,

p15A (ori), CamR, Ptac Promotor, Gene: codonoptimierte Sulfhydryloxidase Erv1p aus Saccharomyces cerevisiae und codonoptimierte humane Proteindisulfid-isomerase (PDI) Zur Verfügung gestellt von Prof. Dr. Lloyd W. Ruddock, University of Oulu, Finnland (Nguyen et al., 2011)

pET23d(+)::HisDapGalNAcT2 5,4 ColE1 ori, f1 ori, bla (ApR), T7 Promotor, Diaminopeptidase spaltbarer HisDap-Tag, Gen: codonoptimierte GalNAcT2 für Expression in E. coli diese Arbeit

pET23a(+)::GalNAcT2 5,3 ColE1 ori, f1 ori, bla (ApR), T7 Promotor, Gen: codonoptimierte GalNAcT2 für Expression in E. coli diese Arbeit

pET23a(+)::gcsf6xHis 4,1 ColE1 ori, f1 ori, bla (ApR), T7 Promotor, Gen: G-CSF, Hexahistidin-Tag

(23)

Fortsetzung von Tabelle 2

Plasmid Größe

(kBp)

Merkmale Herkunft/Referenz

pET23a(+)::HisDapGalNAcT2::gcsf6xHis 5,7 ColE1 ori, f1 ori, bla (ApR), T7 Promotor, Diaminopeptidase spaltbarer HisDap-Tag Gene: codonoptimierte GalNAcT2 für Expression in E. coli, G-CSF, Hexahistidin-Tag diese Arbeit

pET23a(+)::GCSF mit Stopp 4,1 ColE1 ori, f1 ori, bla (ApR), T7 Promotor, Gen: G-CSF Institut für Angewandte Biotechnologie, Hochschule Biberach pQE-T7-2::mrhgcsf10HisFusion 5,7 ColE1 ori, f1 ori,

(KanR), lacI Promotor, Gen: G-CSF, Dekahistidin-Tag

diese Arbeit

pOptiVec::gcsf ohne Stopp 5,0 pUCori, ApR, CMV Promotor, IRES, DHFR, TKpA Gen: G-CSF ohne Stoppcodon Institut für Angewandte Biotechnologie, Hochschule Biberach

(24)

Die für die Sequenzierung verwendeten Oligonukleotide sind in Tabelle 3 aufgeführt. Tabelle 3: Oligodesoxynukleotide Bezeichnung Sequenz (5’-3’) T7 prom 5 TTAATACGACTCACTATAGG T7 term CTAGTTATTGCTCAGCGG Fwd 004 galnac TGCGTAATGATCGTCGTG Fwd 005 galnac TTATGCAGCAGTTCCGAG Fwd 006 galnac CTGCGTCATGTTGGTAGC Rev 001 gcsf AGCATTCTAGGTCCCGCT

Rev 002 galnac TATAAGTCTCGGCAGACCT

Rev 003 galnac GCACAAGCACCACGTCTA

Antikörper

Die in dieser Arbeit verwendeten Antikörper sind in Tabelle 4 und 5 aufgelistet.

Tabelle 4: Primärantikörper (Verdünnung 1:1000)

Bezeichnung und Herkunft Epitop

Polyklonaler Maus Anti-humaner GALNT2 Antikörper (H00002590-A01, Acris Antibody GmbH, Deutschland) Aminosäuren: CHNAGGNQEWALTKEKSVKHMDLCLTVVD RAPGSLIKLQGCRENDSRQKWEQIEGNSK LRHVGSNLCLDSRTAKSG GLSVEVCGPALSQQWKFTLNLQQ

Monoklonaler Maus Penta-His Antikörper (34660, Qiagen, Deutschland)

Aminosäuren: HHHHH (5x Histidin) Polyklonaler Ziege Anti-G-CSF Antikörper

(SC-1318, Santa Cruz Biotechnology, Inc, Deutschland)

(25)

Tabelle 5: Sekundärantikörper (Verdünnung 1:2000)

Bezeichnung Herkunft

HRP-gekoppelter Anti-Maus Antikörper (#7076S)

Cell Signaling, New England Biolabs GmbH, Frankfurt am Main, Deutschland

HRP-gekoppelter Anti-Ziege (whole molecule) Antikörper (A5420)

Sigma-Aldrich Chemie GmbH, Taufkirchen bei München, Deutschland

2.3. Zellkultivierung

2.3.1. Nährmedien

2.3.1.1. Flüssigmedien

Für die Kultivierung der E. coli-Stämme wurde entweder LB-, TB- oder EnPresso® B -Medium verwendet. Die Medien wurden entweder als Pulver (LB und TB, Carl Roth GmbH & Co. KG, Karlsruhe) oder in Tablettenform (EnPresso® B, BioSilta Ltd., Cambridgeshire, UK) erworben und nach Angaben des jeweiligen Herstellers hergestellt.

LB-Medium (Sambrock et al., 1989; mod.)

Zusammensetzung: Trypton 10 g Hefeextrakt 5 g NaCl 10 g H2Odemin. ad 1 l Herstellung: LB (Fertigpulver) 25 g H2Odemin. ad 1 l

(26)

TB-Medium (Sambrock et al., 1989; mod.)

Zusammensetzung:

Casein, enzymatisch verdaut 12 g/l

Hefeextrakt 24 g/l K2HPO4 12,5 g/l KH2PO4 2,3 g/l H2Odemin. ad 1 l Herstellung: TB (Fertigpulver) 50,8 g H2Odemin. ad 1 l

Sterilisation bei 121 °C und 2,1 bar Druck für 15-20 min. Zugabe von 4 ml Glycerol.

EnPresso® B

Die EnPresso® B-Tabletten wurden in sterilem H2Odemin. gelöst. Die detaillierte

Zusammensetzung der Medienkomponenten wurde vom Hersteller (Biosilta Ltd.) nicht zur Verfügung gestellt.

2.3.1.2. Festmedien

Zur Herstellung der LB-Agarplatten wurde LB-Medium (2.3.1.1.) zusätzlich mit 15 g/l Agar-Agar (Kobe I) versetzt und bei 121 °C und 2,1 bar Druck für 15-20 min autoklaviert. Nach dem Autoklaviervorgang wurde der LB-Agar auf 60 °C abgekühlt und mit den jeweiligen Selektivantibiotika versehen (Tabelle 6). Das Gießen der Agar-Platten erfolgte unter der Laminar-Air-Flow (LAF). Die Agarplatten wurden bis zur Verwendung bei 4 °C für maximal 1 Monat aufbewahrt.

(27)

2.3.2. Medienzusätze

In Tabelle 6 sind die verwendeten Antibiotika aufgelistet und in Tabelle 7 ist eine Übersicht weiterer Medienzusätze aufgeführt.

Tabelle 6: Verwendete Antibiotika Antibiotikum Stammlösung (mg/ml) Lösungsmittel Arbeitskonzentration (µg/ml) Ampicillin 120 H2Odemin. 120 Chloramphenicol 34 Ethanol 34 Kanamycin 74 H2Odemin. 74 Tabelle 7: Medienzusätze

Substanz Stammlösung Lösungsmittel Arbeitskonzentration

Arabinose 20 % (w/v) H2Odemin. 0,5 % (w/v)

Glucose 20 % (w/v) H2Odemin. 0,2 % (w/v)

IPTG 1 M H2Odemin. 1 mM

2.3.3. Stammhaltung

Für die Stammhaltung, die zur Aufbewahrung der transformierten Expressionsstämme diente, wurde das CRYOBANK™ System (CRYOBANK™, Mast Diagnostica GmbH, Deutschland) verwendet. Die isolierten Transformanten wurden auf LB-Agarplatten, die mit dem jeweils erforderlichen Selektionsantibiotikum supplementiert waren, ausplattiert. Anschließend wurde eine Kolonie mit einem sterilen Holzzahnstocher von der Agarplatte gepickt und in ein 15 ml Falcon™ Röhrchen mit 2 ml LB-Medium überführt. Die Inkubation erfolgte über Nacht bei 37 °C und 175 rpm. Am Folgetag wurden die Kryokulturen nach Herstellerangaben in den CRYOBANK™-Röhrchen angefertigt und bei -80 °C gelagert.

2.3.4. Anzuchtbedingungen

Für die Anzucht von Bakterienkulturen wurden zwei Keramikkügelchen aus den jeweiligen CRYOBANK™-Röhrchen entnommen und in 50 ml Falcon™ Röhrchen, die mit 2 ml LB-Medium sowie den entsprechenden Antibiotika und 0,2 % (w/v) Glucose befüllt waren,

(28)

transferiert. Die Inkubation erfolgte für 8 h bei 37 °C und 175 rpm in einem Innova® 4200 Inkubationsschüttler (New Brunswick Scientific GmbH, Nürtingen, Deutschland).

2.3.5. Bestimmung der Optischen Dichte

Zur Bestimmung des Wachstums der einzelnen Bakterienkulturen wurde die optische Dichte bei einer Wellenlänge von λ 600 nm mit Hilfe eines Spektralphotometers (Spectramax® M5e, Molecular Devices LLC., USA) gemessen. Dafür wurde 1 ml Bakterienkultur in eine Polystyrol Halbmicro-Küvette mit einer Schichtdicke von 1 cm (Greiner Bio-One GmbH, Frickenhausen) pipettiert. Für die Leerwertbestimmung wurde jeweils 1 ml des verwendeten Mediums verwendet. Ab einer OD600 von 0,8 wurde die Probe mit Medium 1:2 verdünnt und

nochmals gemessen um die Linearität der Messwerte zu gewährleisten.

2.4. Arbeiten mit Nukleinsäuren

2.4.1. Vorbereitung von Geräten und Lösungen

Hitzestabile Lösungen und Gefäße wurden bei 121 °C und 2,1 bar Druck für 15-20 min sterilisiert. Hitzesensitive Lösungen wurden unter der Verwendung von Sterilfiltern mit einer Porengröße von 0,2 µm (Millex-GV, PVDF-Membran, Merck Millipore, Deutschland) filtriert. Hitzeempfindliche Geräte wurden mit 70 %-igen Ethanol gereinigt.

2.4.2. DNA-Präparationen

Die Isolierung der Plasmid-DNA erfolgte nach einer alkalischen Lyse der Bakterienzellen (Birnboim und Doly, 1979) und der anschließenden reversiblen Bindung der Plasmid-DNA an die DNA-spezifische Silicagel-Membran.

Das eingesetzte Volumen einer Übernachtkultur für eine Mini-Präparation betrug 10 ml. Bei einer Midi-Präparation wurden 100 ml verwendet. Für Mini-Präparationen wurde der „Roti® -Prep Plasmid MINI Kit“ (Carl Roth GmbH& Co.KG, Karlsruhe) und für Midi-Präparationen (2.1.3.) der „QIAGEN Plasmid Midi Kit“ (Qiagen, Hilden) verwendet. Die Präparationen wurden nach Angaben des jeweiligen Herstellers durchgeführt.

(29)

2.4.3. DNA-Konzentrationsbestimmung

Zur Bestimmung der DNA-Konzentrationen wurden Messungen mit Hilfe des NanoDrop 1000 Spektrophotometers nach Herstellerangaben durchgeführt (NanoDrop Technologies, Inc. Thermo Scientific, Wilmington Delaware, USA).

Bei einer Wellenlänge von λ 260 nm weist doppelsträngige DNA bei einem Extinktionswert von 1 eine Konzentration von 50 µg/ml auf (Green und Sambrook, 2012). Die Reinheit der DNA-Lösung kann über die Verhältnisse A260/A280 und A260/A230 beurteilt werden.

Verunreinigungen mit Proteinen können durch die Berechnung von A260/A280 detektiert

werden, wobei die resultierenden Werte idealerweise in einem Intervall von 1,8 bis 2,0 liegen sollten (NanoDrop Technologies, Inc. Thermo Scientific, Wilmington Delaware, USA) (Green und Sambrook, 2012). Ein Hinweis auf mögliche Verunreinigungen mit Salzen liefert das Verhältnis A260/A230, welches nach Herstellerangaben zwischen 2,0 und 2,2 liegen sollte

(NanoDrop Technologies, Inc. Thermo Scientific, Wilmington Delaware, USA) (Green und Sambrook, 2012).

2.4.4. Verdau von DNA mit Restriktionsenzymen

Die Restriktion der isolierten Plasmid-DNA erfolgte analytisch (500 ng DNA) und präparativ (5-10 µg DNA). Die eingesetzten Restriktionsenzyme wurden nach Herstellerangaben (Fermentas, Thermo Fisher Scientific Inc., St. Leon-Rot) eingesetzt. Der Restriktionsverdau wurde für 1,5-2 h bei 37 °C durchgeführt.

2.4.5. Dephosphorylierung von DNA-Fragmenten

Die Religation eines verdauten Vektors wird durch die enzymatische Abspaltung der Phosphatgruppe am 5‘-Ende verhindert (Green und Sambrook, 2012). Dafür wurden pro µg DNA je 1 µl (1U/µl) „FastAP Thermosensitive Alkaline Phosphatase“ (Fermentas, Thermo Fisher Scientific Inc., St. Leon-Rot) zur Dephosphorylierung in den Restriktionsansatz pipettiert. Die Inkubation erfolgte für 10 min bei 37 °C, gefolgt von der Inaktivierung der „FastAP Thermosensitive Alkaline Phosphatase“ für 5 min bei 75 °C. Bis zur gelelektrophoretischen Auftrennung wurden die Reaktionsansätze auf Eis gelagert.

(30)

2.4.6. Gelelektrophoretische Auftrennung von DNA-Fragmenten

Für die gelelektrophoretische Auftrennung von DNA-Fragmenten unterschiedlicher Größe wurde eine 1 %-ige Agaroselösung in 100 ml TAE-Puffer hergestellt. Das Gemisch wurde bis zum vollständigen Auflösen der Agarose im TAE-Puffer erhitzt. Nach dem Abkühlen auf ca. 60 °C wurden 5 µl „Roti®-GelStain“ in die Lösung pipettiert und durch mehrmaliges Schwenken vermischt. Die Benzimidazol-Derivate in „Roti®-GelStain“ (Carl Roth GmbH & Co. KG) binden an die kleine Furche der helikalen DNA (Hilwig und Gropp, 1972; Rajarajeswari et al., 2014). Anschließend wurde das Agarosegel mit der erwünschten Anzahl an Geltaschen gegossen. Pro Restriktionsansatz wurden je 1/6 des Volumens an „6xTriTrack™ Loading Dye Solution“ hinzugegeben. Es wurden jeweils 8 µl der verwendeten DNA-Größenmarker, „GeneRuler™ 100 bp Plus DNA Ladder (100-3000 bp)“ bzw. „GeneRuler™ 1 kb DNA Ladder (250-10000 bp)“, pro Geltasche eingesetzt (Fermentas, Thermo Fisher Scientific Inc., St. Leon-Rot; Abbildung 3). Die elektrophoretische Auftrennung erfolgte für 1,5-2 h bei 110 Volt. Dabei wandert die negativ geladene DNA in dem angelegten elektrischen Feld zur Anode (Green und Sambrook, 2012). Nach Beendigung der Elektrophorese wurden die DNA-Banden unter UV-Belichtung (λ 320 nm) in der Geldokumentationsanlage (Fusion FX, Vilbert Lourmat) ausgewertet. Die Zusammensetzung des 50x TAE-Puffers ist im Folgenden aufgeführt. Die erwarteten Bandenmuster der DNA-Größenmarker sind in Abbildung 3 dargestellt.

50x TAE-Puffer (Sambrock et al., 1989; mod.)

Tris/HCl (pH 7,5) 242,3 g 2 M

Eisessig 57,1 g 1 M

EDTA 14,6 g 50 mM

(31)

Abbildung 3: Für die Agarosegelelektrophorese verwendete DNA-Größenstandards von Fermentas Thermo Fisher Scientific Inc., St. Leon-Rot. „GeneRuler™ 100 bp Plus DNA Ladder” (A) und „GeneRuler™ 1 kb DNA Ladder” (B); Thermo Fisher Scientific (Quelle: www.thermofisher.com)

2.4.7. Gelextraktion

Zur Isolierung wurden nach Beendigung der Gelelektrophorese die aufgetrennten DNA-Fragmente mit Hilfe eines Skalpells aus dem Gel ausgeschnitten und in ein 1,5 ml Eppendorfgefäß überführt. Das Gewicht des Agarosestreifens wurde bestimmt und die DNA mit dem „QIA-quick® Gel Extraktion Kit“ (QIAGEN, Hilden) nach Herstellerangaben extrahiert. Daraufhin wurde die Konzentration der extrahierten DNA-Menge durch Verwendung des NanoDrop 1000, UV-Vis Spektrophotometers (Thermo Scientific), gemessen (2.4.3.).

2.4.8. Ligation

Zur Ligation von DNA-Fragmenten (Weiss et al., 1968) wurden verschiedene Mischungsverhältnisse der Vektor-DNA zur Insert-DNA eingesetzt. Das Verhältnis von Vektor-DNA- zu Insert-DNA-Konzentration wurde zwischen 1:3 und 1:5 variiert. Für die Religationskontrolle wurde Wasser anstelle des Inserts mitgeführt (Tabelle 8).

(32)

Tabelle 8: Pipettierschema der Ligationsansätze Ligationsansätze 1:3 1:5 Negativkontrolle Vektor DNA 100 ng 100 ng 100 ng Insert DNA 300 ng 500 ng - 10x T4 DNA Ligase Puffer 4 µl 4 µl 4 µl T4 DNA Ligase (5U/µL) 1 µl 1 µl 1 µl ATP 100 mM 1 µl 1 µl 1 µl

H2Odemin. auf 40 µl aufgefüllt auf 40 µl aufgefüllt auf 40 µl aufgefüllt

Gesamtvolumen 40 µl 40 µl 40 µl

Mit Hilfe des Thermocyclers „Mastercycler gradient“ (Eppendorf) konnte ein Ligationsgradientenprogramm erstellt werden (Tabelle 9).

Tabelle 9: Ablauf des Ligationsgradientenprogrammes

Temperaturgradient

(°C) 4 6 8 10 12 14 16 18 20 22 25 65 4

Zeit

(min) 5 5 5 5 5 5 5 5 5 30 10 15 endlos

Anschließend wurde die DNA der Ligationsansätze mit Ethanol gefällt. Zu 40 µl DNA-Lösung wurden 4 µl 3 M NaAc pH 5 und 120 µl 100 %-iges unvergälltes Ethanol pipettiert. Vor Zugabe wurden die Reagenzien für 30 min bei -20 °C vorgekühlt und weitere 10 min auf Eis gekühlt. Danach erfolgte ein Zentrifugationsschritt bei 4 °C, 13 200 rpm für 15 min. Der Überstand wurde verworfen und das Pellet mit 1 ml 70 %-igem Ethanol versetzt. Nach weiteren 5 min Kühlung auf Eis wurde der Zentrifugationsschritt wiederholt. Das Pellet wurde nach Verwerfen des Überstandes für 10 min an der Luft getrocknet und in 10 µl H2O-EF

(33)

aufgenommen. Die gesamte Probe wurde im Anschluss für einen Transformationsansatz (2.5) eingesetzt.

2.4.9. Kontrollverdau

Die isolierte Plasmid-DNA aus den kultivierten Zellen wurde durch einen analytischen Verdau mit Restriktionsendonukleasen überprüft. Für jeden Reaktionsansatz wurden 0,5 µg Plasmid-DNA eingesetzt. Die Durchführungen der Einzel- bzw. Doppelverdaue in Gegenwart spezifischer Restriktionsendonukleasen wurden nach Angaben des Herstellers durchgeführt und nach Beendigung der Agarosegelelektrophorese analysiert.

2.4.10. DNA-Sequenzierung

Jeweils zwei Proben der mittels Kontrollverdau erfolgreich überprüften Plasmid-DNA wurden zur Sequenzierung eingeschickt (SRD, Bad Homburg). Die DNA-Konzentration der Proben wurde nach Firmenvorgabe eingestellt und betrug zwischen 0,06 µg/µl und 0,2 µg/µl.

Für die Analyse der Sequenzierungsdaten wurde das Programm DNASTAR Lasergene 10 Core Suite / SeqManPro verwendet.

2.5. Herstellung und Transformation elektrokompetenter E. coli-

Zellen

Für die Herstellung elektrokompetenter E. coli-Zellen (Dower et al., 1988) wurden 10 ml LB-Medium mit den jeweiligen Selektivantibiotika durch Zugabe von 50 µl Kryostockkultur inokuliert. Die Inkubation erfolgte für 8 h bei 37 °C und 200 rpm. Anschließend wurde die Vorkultur in einen 2 l Schikanekolben mit 200 ml LB-Medium, das mit den erforderlichen Selektivantibiotika supplementiert war, überführt. Die Inkubation erfolgte über Nacht bei 37 °C und 145 rpm. Am Folgetag wurden die Übernachtkultur mit 300 ml LB-Medium (+ 0,2 % (w/v) Glucose und Antibiotika) verdünnt und die OD600 bestimmt. Anschließend

erfolgte die weitere Inkubation der Kultur bei 37 °C und 145 rpm bis eine Zelldichte von OD600 0,8-2,0 erreicht wurde. Das in den nachfolgenden Schritten verwendete H2Odemin als

auch die 10 %-ige (v/v) Glycerollösung wurden bei 121 °C und 2,1 bar Druck für 15-20 min sterilisiert und bis zur Verwendung auf Eis gekühlt. Für die anschließende Zentrifugation wurde die Zellsuspension in sterile Nalgene®-Zentrifugenbecher (Nalgene Nunc International, New York, USA) transferiert und bei 4 °C und 4800 x g für 5 min geerntet. Das Zellpellet wurde mit 500 ml, auf Eis vorgekühltem, demineralisierten H2O gewaschen und erneut

(34)

zentrifugiert. Im nachfolgenden Waschschritt wurde das Zellpellet in 50 ml 10 % (v/v) eiskaltem Glycerol aufgenommen und wie bereits beschrieben zentrifugiert. Nach Beendigung des Waschschrittes wurde das Zellpellet in insgesamt 11 ml eiskaltem Glycerol (10 % (v/v)) aufgenommen. Die Pulszeit der elektrokompetenten Zellen wurde überprüft, indem 110 µl der Zellsuspension in eine Elektroporationsküvette mit 2 mm Spalt überführt und an diese mit Hilfe des BIO-RAD-Micropulser™ (Bio-Rad Laboratories GmbH, München) ein kurzer elektrischer Impuls angelegt wurde. Lag die ermittelte Pulszeit unter 5 ms so wurde ein zusätzlicher Waschschritt mit 10 % (v/v) eiskaltem Glycerol durchgeführt. Wurde die Pulszeit von 5 ms überschritten so wurde die Zellsuspension in 110 µl Aliquots in sterile Eppendorfgefäße pipettiert, auf Trockeneis schockgefroren und anschließend bei -80 °C aufbewahrt.

Für die Transformation wurden die elektrokompetenten E. coli-Zellen auf Eis aufgetaut, ca. 100 ng Plasmid-DNA in die Zellsuspension pipettiert und für 1 min inkubiert. Zur Elektroporation wurde die DNA-Zellmischung in Elektroporationsküvetten mit 2 mm Spalt transferiert. Mit dem BIO-RAD-Micropulser™ (Bio-Rad Laboratories GmbH, München) wurde ein elektrischer Impuls angelegt (Spannung 2,5 KV, Elektrisches Feld 12,5 kV/cm). Die Pulszeiten der Elektroporationen lagen generell zwischen ca. 4,2-5,4 ms. Nach der Transformation wurden die Zellen in 1 ml vorgewärmtem LB-Medium aufgenommen, und für 30-45 min bei 37 °C, 300 rpm inkubiert. Von dieser Bakterienkultur wurden 100 µl auf einer Selektivagarplatte mit einem Drigalskispatel ausplattiert. Die verbliebene Bakterienkultur wurde für 5 min bei 5000 x g zentrifugiert, das Zellpellet in 100 µl LB-Medium aufgenommen und wie bereits beschrieben ausplattiert. Die Inkubation der Agarplatten erfolgte über Nacht bei 37 °C.

2.6. Expression der HisDapGalNAcT2-Glykosyltransferase in E.

coli-Stämmen

Die in dieser Arbeit verwendeten E. coli-Expressionsstämme weisen im Genom das integrierte T7 RNA Polymerase Gen auf. Diese Polymerase ermöglicht die spezifische Expression von Genen die unter der Kontrolle des T7-Promotors stehen (Studier und Moffatt, 1986). Das Gen für die HisDapGalNAcT2-Glykosyltransferase befand sich auf einem pET23d(+)-Vektor, der den T7 Promotor trägt (Rosenberg et al., 1987; Studier und Moffatt, 1986). Auf dem Plasmid pMJS9 konnte die Expression der beiden Faltungshelfer über einen Arabinosepromotor reguliert werden (Guzman et al., 1995).

(35)

2.6.1. Expression in E. coli Origami

TM

2(DE3)pLysS

OrigamiTM 2(DE3)pLysS weist im Vergleich zu anderen E. coli-Expressionsstämmen ein weniger reduzierendes Zytoplasma auf, welches die Bildung von Disulfidbrücken ermöglichen kann (Lobstein et al., 2012; Volonté et al., 2011). Dieses Milieu wird durch die Mutationen in der Thioredoxinreduktase (trxB) und der Glutathionreduktase (gor) ermöglicht (Novagen, Merck Millipore, Deutschland).

Die Kultivierung der OrigamiTM 2(DE3)pLysS-Zellen in Expressionsexperimenten erfolgte in LB-Medium (0,2 % w/v Glucose, 120 µg/ml Ampicillin). Die Vorkultur wurde wie in 2.3.4. beschrieben vorbereitet und das Inokulum auf eine OD600 von 0,5 eingestellt. Die OrigamiTM

2(DE3)pLysS–Bakterienkultur wurde in Expressionsversuchen in „6-Well Suspension Culture

Plates“ (Greiner Bio-One International GmbH, Frickenhausen, Deutschland) oder in 200 ml

Schikanekolben kultiviert (Tabelle 10). Nachdem die Kultur eine OD600 von 0,8 aufwies wurde

die Expression der HisDapGalNAcT2-Glykosyltransferase durch Zugabe von 1 mM Isopropyl-β-D-thiogalactopyranosid (IPTG) induziert. Nach einer Inkubationszeit von 4 h bei 30 °C erfolgte die Ernte der E. coli-Zellen. Die Expressionskultur wurde in 15 oder 50 ml Falcon™ Röhrchen überführt und bei 4 °C, 5500 x g für 5 min zentrifugiert.

Die für die Expressionsversuche eingesetzten Kultivierungsgefäße sind in Tabelle 10 aufgeführt.

Tabelle 10: In den Expressionsversuchen eingesetzte Kultivierungsgefäße

Gefäß Expressionsvolumina Schüttelfrequenz

„6-Well Suspension Culture Plate“ 4 ml 145 rpm

200 ml Schikanekolben 50 ml 145 rpm

2.6.2. Expressionversuche in E. coli SHuffle

®

T7

Der E. coli-Expressionsstamm SHuffle® T7 weist zusätzlich zu den beiden Mutationen trxB und gor (2.6.1) das chromosomal integrierte DsbC-Gen auf, welches für die Disulfidbrückenisomerase DsbC codiert (Berkmen, 2012; Lobstein et al., 2012; Peciak et al., 2014). Das Gen wurde modifiziert indem die N-terminale Signalsequenz entfernt wurde und dadurch kein Transport des E. coli-eigenen Chaperons DsbC in das Periplasma erfolgt (Faulkner et al., 2008; McCarthy et al., 2000). Durch diese Änderung wurde die Coexpression von DsbC im Zytoplasma ermöglicht. Der eingesetzte E. coli-Expressionsstamm enthielt zusätzlich das Plasmid pMJS9, welches für die Präexpression

(36)

der beiden codonoptimierten Faltungshelfer Erv1p und PDI notwendig ist (Nguyen et al., 2011).

Für die Inokulation der Expressionskultur wurden zwei Keramikkügelchen aus dem CRYOBANK™-Kryoröhrchen entnommen und die Zellen wie in 2.3.4. beschrieben kultiviert. Die Kultur wurde in einen 2 l Schikanekolben mit 200 ml EnPresso® B -Medium (120 µg/ml Ampicillin, 34 µg/ml Chloramphenicol, 100 µl Reagent A) überführt (Tabelle 11). Die Inkubation erfolgte bei 30 °C, 175 rpm für 15 h. Die Zugabe der Boosterlösung wurde nach Angaben des Herstellers durchgeführt. Die Induktion der Expression der auf Plasmid pMJS9 kodierten Genprodukte Erv1P und PDI erfolgte durch Zugabe von 0,5 % (w/v) Arabinose zur

E. coli Kultur. Nach 30 min wurde die Expression der Glykosyltransferase HisDapGalNAcT2

durch die Zugabe von Isopropyl-β-D-thiogalactopyranosid (IPTG) (Endkonzentration von 1 mM) induziert. Es folgte ein weiterer Inkubationsschritt bei 30 °C, 175 rpm für 23,5 h. Anschließend wurden die E. coli-Zellen geerntet indem aus der Kulturbrühe 10 ml Aliquots entnommen und bei 4 °C, 5500 x g für 5 min abzentrifugiert wurden. Die Überstände wurden verworfen und die pelletierten Bakterienzellen bei -80 °C gelagert.

Für die Herstellung eines Expressionsansatzes im 1,5 l-Maßstab wurden die beschriebenen Versuchsbedingungen (2.6.2.) modifiziert. Zur Inokulation von 1,5 l Expressionsmedium in einem 2 l Bioreaktor (Sartorius Stedim Biotech GmbH, Göttingen, Deutschland) wurden 15 ml Vorkultur verwendet. Kultivierung und Expression erfolgten bei 30 °C, 60 % pO2,0,5 vvm,

pH 7. Die Zellsedimente wurden unter den zuvor beschriebenen Bedingungen (2.6.1.) geerntet und bei -80 °C gelagert.

Für die Untersuchungen der in vivo Glykosylierung wurde zeitgleich mit der Zugabe von IPTG zusätzlich Uridin-Diphosphat-N-Acetylgalactosamin (UDP-GalNAc) (Endkonzentration: 5 mM) zur SHuffle® T7-Expressionskultur hinzugegeben.

Tabelle 11: Für die Expression in SHuffle® T7 eingesetzte Kultivierungsgefäße

Gefäß Expressionsvolumina Schüttelfrequenz

24-DeepWell Platte (BioSilta Ltd., Cambridgeshire, UK)

2 ml 250 rpm

2 l Schikanekolben 200 ml 175 rpm

2 l Fermenter 1,5 l Kaskadenregelung: Die

Sauerstoffsättigung (pO2

60 %) wurde durch die Anpassung der Rotorgeschwindigkeit gewährleistet

(37)

2.7. Proteinisolierung und Proteinanalyse

2.7.1. Herstellung von Zellextrakten

Das Zellpellet einer 10 ml Bakterienkultur wurde in 1,26 ml Extraktionspuffer (50 mM Tris, 300 mM NaCl, pH 8) supplementiert mit 140 µl Lysozymstocklösung (10 mg/ml), 3 µL Desoxyribonuklease I (ca. 15 Units, DNaseI, Sigma-Aldrich Chemie GmbH, Taufkirchen bei München, Deutschland) und 50 µl Proteaseinhibitor (complete protease inhibitor cocktail

tablet, F. Hoffmann La-Roche AG, Switzerland) resuspendiert. Die Bakteriensuspension

wurde anschließend für 30 min auf Eis gelagert. Der Zellaufschluss erfolgte auf Eis mittels des SONOPLUS Homogenisators (Bandelin Sonoplus HD2070) unter Verwendung der Mikrospitze MS72 (Zyklen: 7, Amplitude: 70 %, Dauer: 3 min). Die Separation der Zellfragmente (partikuläre Fraktion) von der löslichen Fraktion erfolgte durch Zentrifugation bei 4 °C mit 16 100 x g für 10 min.

Die E. coli-Zellsedimente aus den Fermentationsläufen wurden wie bereits beschrieben aufgeschlossen. Die Volumina des supplementierten Extraktionspuffers wurden angepasst. Der Aufschluss der Zellen erfolgte mit der Sonde VS 70 T.

2.7.2. Metallchelatchromatographie (engl. immobilized metal affinity

chromatography, IMAC)

Die Metallchelatchromatographie stellt eine Methode zur selektiven Isolation der mit 6-10 Histidinresten versehenen Proteine aus Proteingemischen dar (Porath et al., 1975). Die hohe Affinität der aufeinanderfolgenden Histidine zu zweiwertigen Ionen wie beispielsweise Ni2+ oder Co2+ wird bei der Metallchelatchromatographie ausgenutzt. Die Elution der gebundenen Proteine kann anschließend durch das Strukturanalogon Imidazol oder einem pH ≤7 erfolgen (Porath et al., 1975; Schmitt et al., 1993).

2.7.2.1. Nickel-Nitrilotriessigsäure-Affinitätschromatographie (Ni-NTA) 2.7.2.1.1. Ni-NTA-Spin Säulen

Die mit Hilfe des Zellaufschlusses gewonnene lösliche Proteinfraktion wurde filtriert (0,45 µM Filter, Millex-HV, PVDF-Membran, Merck Millipore) um Zellfragmente zu entfernen. Für die Aufreinigung von 0,5 – 1,4 ml löslicher Proteinfraktion wurden Ni-NTA Spin Säulen (Qiagen, Hilden) verwendet. Die Durchführung erfolgte nach Angaben des Herstellers. Der Äquilibrationspuffer entsprach der Zusammensetzung des in 2.7.1. aufgeführten Extraktionspuffers. Wasch- und Elutionspuffer wurden auf einen pH-Wert von 8 eingestellt. Im Folgenden werden die Zusammensetzungen der verwendeten Puffer aufgeführt.

(38)

Extraktionspuffer/Äquilibrationspuffer pH 8 Tris 1,2 g 50 mM NaCl 3,5 g 300 mM H2Odemin. ad 200 ml Waschpuffer, pH 8 Tris 1,2 g 50 mM NaCl 3,5 g 300 mM Imidazol 0,2 g 20 mM H2Odemin. ad 200 ml Elutionspuffer, pH 8 Tris 1,2 g 50 mM NaCl 3,5 g 300 mM Imidazol 6,8 g 500 mM H2Odemin. ad 200 ml 2.7.2.1.2. ÄKTA Purifier

Die Aufreinigung der HisDapGalNAcT2-Glykosyltransferase erfolgte über eine HisTrap HP 1 ml Säule (GE Healthcare Life Science GmbH) unter Verwendung einer ÄKTA Purifier Anlage (GE Healthcare Life Science GmbH). Die Äquilibrierung der HisTrap HP Säule erfolgt mit 8 CV (column volume = Säulenvolumen) Äqulibrationspuffer. Eine 7,98 g-Fraktion des isolierten Zellsediments wurde wie in 2.7.2.1.1. beschrieben aufbereitet und 29 ml der isolierten Proteinlösung in einen 50 ml Superloop™ (GE Healthcare Life Science GmbH) geladen. Die Beladung der HisTrap HP 1 ml Säule erfolgte mit 29 CV. Ein nachgeschalteter Waschschritt mit 8 CV Waschpuffer wurde durchgeführt, um unspezifisch gebundene Proteine vom Säulenmaterial zu entfernen. Das Zielprotein HisDapGalNAcT2 wurde mit Hilfe eines Gradienten (100 % Elutionspuffer, 2.7.2.1.1.), der über 4 CV angelegt worden war, eluiert. Es wurden je 1 ml Proteinfraktionen gesammelt. Bis zur späteren Analyse wurden die Proteinfraktionen bei 4 °C aufbewahrt. Die HisTrap HP 1 ml Säule wurde nach der

(39)

Proteinaufreinigung mit 5 CV Elutionspuffer regeneriert, nach Herstellerangaben gereinigt und bei 4 °C gelagert.

2.7.2.1.3. Verwendung von Ni-NTA - Säulenmaterial

Für die Aufreinigung der wie in 2.7.2.1.1. filtriert und zentrifugierten Proteinprobe wurden 0,5 ml 50 % Ni-NTA-Resinsuspenion in 30 % Ethanol, in ein 2 ml Eppendorfgefäß pipettiert und dieses Ni-NTA-Säulenmaterial mit 480 µl der löslichen HisDapGalNAcT2 Proteinfraktion vermischt.

Anschließend erfolgte die Inkubation bei 4 °C für 1 h durch Überkopfrotation. Die Ni-NTA-Proteinsuspension wurde bei 100 x g für 4 min zentrifugiert. Anschließend folgten zwei Waschschritte mit 3 CV Waschpuffer bei 100 x g für 4 min. Nach Beendigung der Waschschritte wurde 1 CV Elutionspuffer hinzu pipettiert, 5 min durch Überkopfrotation bei Raumtemperatur inkubiert und anschließend bei 100 x g und 4 min zentrifugiert. Das Eluat wurde in ein 2 ml Eppendorfgefäß überführt. Nach der Wiederholung des Elutionsschritts wurden beide Eluatfraktionen vereint.

Die Zusammensetzung der verwendeten Puffer wird im Folgenden aufgeführt.

Extraktionspuffer/Waschpuffer, pH 8 Natriumphosphat 0,2 g 50 mM NaCl 0,8 g 300 mM H2Odemin. ad 50 ml Elutionspuffer, pH 8 Natriumphosphat 0,2 g 50 mM NaCl 0,8 g 300 mM Imidazol 0,5 g 150 mM H2Odemin. ad 50 ml

(40)

2.7.2.2. Cobalt-Affinitätschromatographie

Für die Aufreinigung unter Anwendung von TALONspin® Säulen (Takara Bio Europe/Clontech, France) wurden 480 µl der löslichen Proteinfraktion (wie in 2.7.2.1.) nach Angaben des Herstellers aufgereinigt. Alle verwendeten Puffer (2.7.2.1.3.) wiesen einen pH von 8 auf. Mit Hilfe der 150 mM Imidazol im Elutionspuffer konnten die Proteine von der Säule eluiert werden (Hengen, 1995).

2.7.3. Konzentrierung von Proteinlösungen mittels Ultrafiltration

Für die Aufkonzentrierung der Proteinlösungen wurden Vivaspin® 500

Zentrifugalkonzentratoren (10 000 MWCO PES, Sartorius Stedim Biotech GmbH, Göttingen, Deutschland) verwendet. Bei den Zentrifugalkonzentratoren handelt es sich um Ultrafiltrationseinheiten, die die Konzentrierung von biologischen Proben ermöglichen (Sartorius Stedim Biotech GmbH, Göttingen, Deutschland). Es wurden 500 µl Proteinlösung in die Vivaspin® 500 Filtrationseinheiten pipettiert und für 30 min bei 9 000 x g zentrifugiert. Dieser Zentrifugationsschritt wurde wiederholt, bis die entsprechende Volumenreduktion der Proteinlösung erzielt war. Anschließend wurde die Proteinkonzentration bei einer Wellenlänge von λ 280 nm mittels eines NanoDrop 1000 Spektrophotometers (Thermo Scientific) bestimmt. Probenvolumina > 1 ml wurden unter Verwendung von Amicon Ultra-4 Zentrifugenröhrchen (Amicon Ultra Devices, Millipore Corporation, Bedford, USA) unter Berücksichtigung der Herstellerangaben aufkonzentriert.

2.7.4. Diafiltration der Proteinlösungen

Die Diafiltration erfolgte mittels Vivaspin® 500 Zentrifugalkonzentratoren (2.7.3.). Das Probenvolumen im Vivaspin® 500 wurde nach jedem Zentrifugationsschritt mit dem Zielpuffer auf ein Endvolumen von 500 µl aufgefüllt. Dieser Arbeitsschritt wurde fünfmal wiederholt.

2.7.5. Bestimmung der Proteinkonzentration mittels BCA-Assay

Die Bestimmung der Proteinkonzentration im Eluat erfolgte kolorimetrisch mit Hilfe des BCA-Proteinassays (Smith et al., 1985). Durch die quantitative Reduktion von Cu2+-Ionen durch das vorliegende Protein kann sich ein intensiv gefärbter Komplex mit zwei Bicinchoninsäure

(41)

(BCA) Molekülen bilden. Dieser farbliche Komplex kann durch die Absorptionsmessung bei λ

560 nm detektiert werden (Smith et al., 1985; Wiechelman et al., 1988).

Der Assay wurde im 100 µl Maßstab in 96-Well Mikrotiterplatten (flat-bottom, Greiner Bio-One GmbH, Frickenhausen) durchgeführt. Hierfür wurde die Proteinprobe zuvor sowohl 1:2 als auch 1:5 in phosphatgepufferter Salzlösung (engl. phosphate buffered saline, PBS) verdünnt und anschließend jeweils 10 µl der hergestellten Lösung mit 90 µl BCA-Arbeitslösung in eine Wellplatte pipettiert. Für die Messungen wurden Doppelansätze hergestellt. Zur Bestimmung der Kalibriergeraden wurde bei jeder Messung ein Rinderserumalbuminstandard (engl. bovine serum albumin, BSA) mit den Konzentrationen von 0-1 mg/ml mitgeführt. Die Mikrotiterplatte mit den Reaktionsansätzen wurde mit einer Abdeckfolie zugeklebt und für 30 min bei 37 °C inkubiert. Anschließend wurde der gebildete Farbkomplex bei einer Wellenlänge von λ 560 nm im Spektrophotometer (Spectramax® M5e, Molecular Devices LLC., USA) gemessen. Die verwendeten Lösungen sind im Folgenden aufgelistet. BCA-Reagenz (Lösung A) 1 g Dicarboxy-2,2’-Bicinchonin-[4,4’]-Säure 2 g Na2CO3 x 10 H2O 950 mg NaHCO3 400 mg NaOH 230 mg Kalium-Natriumtartrat

in H2Obidest. aufgelöst, mit Natronlauge pH = 11,25 eingestellt und auf 100 ml

aufgefüllt

Kupfersulfatlösung (Lösung B)

4 g CuSO4 x 5 H2O

Ad 100 ml H2Obidest.

BCA-Arbeitslösung (Lösung C)

5 ml Lösung A wurden mit 100 µl Lösung B gemischt (Mischung im Verhältnis 50:1)

BSA-Stammlösung (1 mg/ml)

Figure

Updating...

References

Related subjects :