II. Materials and methods
II.8 Quantitative PCR (qPCR)
DNA and cDNA fragments were quantified using quantitative PCR (qPCR). Reactions were performed on iCycler IQ thermocyclers (Bio-Rad, Munich, Germany) in 96-well microplates (Bio-Rad). Solutions and oligonucelotide primers used for qPCR are listed in II.8.1 and II.8.3.
Samples and standards were quantified in duplicates. After addition of the reaction mix, plates were sealed with optical tape (Bio-Rad, Munich, Germany). Fluorescein solution (FITC, 1mM, Biorad) was added to the reaction mix as calibration dye to optimize camera adjustments. To detect the amplification kinetics during qPCR, the ready-mix contained the DNA stain SybrGreen I (Sigma Aldrich) which leads to an increase in fluorescence intensity simultaneous to amplification of dsDNA during cycles. Data analysis was carried out with iCycler software (Bio-Rad). The cycle at which the fluorescence of a certain target molecule number exceeded the background fluorescence (threshold cycle [CT]) was determined from dilution series of target DNA with defined target molecule amounts. CT was proportional to the logarithm of the target molecule number. Thus, a CT measured in a sample could be converted to a target molecule number.
II.8.1 Solutions for qPCR
The following solutions were used for quantitative PCR.
Table II.8-1: Solutions for qPCR
Component: Source:
Sybr Green Jumpstart Taq Ready-Mix Sigma Aldrich, Taufkirchen, Germany MgCl2 50 mM Provided with Ready-Mix (see above) Fluorescein (FITC) calibration dye Bio-Rad, Munich, Germany
dilute 1:1000 in nuclease-free water
BSA 20 µg/µl Roche, Grenzach-Wyhlen, Germany
II.8.2 qPCR assays
The used primers are listed in Table II.8-2. For every quantification a negative control was performed by adding the appropriate amount of water instead of DNA or cDNA template.
Table II.8-2: Oligonucelotide primers used for qPCR
Target gene Primer Sequence (5’ 3’) Reference
pmoA A189f GGNGACTGGGACTTCTGG Holmes et al., 1995
mb661 CCGGMGCAACGTCYTTACC Costello et al., 1999
Forest675r CCYACSACATCCTTACCGAA Kolb et al., 2003
amoA archaea amo196f GGWGTKCCRGGRACWGCMAC Treusch et al., 2005
amo277r CRATGAAGTCRTAHGGRTADCC Treusch et al., 2005
amoA bacteria amoA-1F GGGGTTTCTACTGGTGGT Avrahami et al., 2003
amoA-2R CCCCTCGGGAAAGCCTTCTTC Avrahami et al., 2003
16S rRNA A364aF CGGGGYGCASCAGGCGCGAA Burggraf et al., 1997 archaea A934b GTGCTCCCCCGCCAATTCCT Grosskopf et al., 1998 16S rRNA Ba519f CAGCMGCCGCGGTAANWC Lane, 1991
bacteria Ba907r CCGTCAATTCMTTTRAGTT Lane, 1991
‘Wobble’ positions: K = G/T; H = A/C/T; M = A/C ; N = A/C/G/T; R = A/G; S = G/C, W = A/T, Y = C/T
II.8.2.1 Quantification of USCα pmoA
For quantification of pmoA genes and transcripts of USCα from DNA and cDNA SIP-fractions, the following conditions and temperature profile were used. USCα pmoA amplified from Marburg forest soil (MF) and cloned into E. coli Top10 competent cells using primers A189f/Forest675r (see II.6.1) was used as standard in dilution series (101-107 copies).
Table II.8-3: qPCR conditions for quantification of USCα pmoA
qPCR reaction mixture: Thermal profile:
Component Final conc. Volume Temperature program Cycles
2x SybrGreen Ready-Mix 1x 12.5 µl 94°C, 6 min 1
50 mM MgCl2 4 mM 2 µl 94°C, 25 s
50 µM A189f 1 µM 0.5 µl 67°C, 20 s 45 (plate read)
50 µM Forest675r 1 µM 0.5 µl 72°C, 45 s 20 µg/µl BSA 0.5 µg/µl 0.625 µl 82°C, 10 s
1:1000 FITC 0.25 µl 75.0 -94.8°Ca, 6 s 100 (melting curve)
DNA or cDNA template 1 µl 4°C, 5 min 1
Distilled water ad 25 µl
a Melting curve: Set point temperature decreased after cycle 2 by 0.2°C for each cycle.
II.8.2.2 Quantification of general pmoA
For quantification of pmoA genes and transcripts of methanotrophs from DNA and cDNA SIP-fractions, the following condition and temperature profile was used. pmoA amplified from methanotroph type I pure culture Methylomonas sp., cloned into E. coli Top10 competent cells was used as standard in dilution series (101-107 copies).
Table II.8-4: qPCR conditions for quantification of general pmoA
qPCR reaction mixture: Thermal profile:
Component Final conc. Volume Temperature program Cycles
2x SybrGreen Ready-Mix 1x 12.5 µl 94°C, 6 min 1
50 mM MgCl2 4 mM 2 µl 94°C, 25 s
50 µM A189f 0.667 µM 0.33 µl 65.5°C, 20 s 45 (plate read) 50 µM mb661 0.667 µM 0.33 µl 72°C, 35 s
1:1000 FITC 0.25 µl 72°C, 10 s
DNA or cDNA template 1 µl 75.0 -94.8°Ca, 6 s 100 (melting curve)
Distilled water ad 25 µl 4°C, 5 min 1
a Melting curve: Set point temperature decreased after cycle 2 by 0.2°C for each cycle.
II.8.2.3 Quantification of archaeal amoA
For quantification of amoA genes and transcripts of Archaea from DNA and cDNA SIP-fractions, and soil extracts, the following condition and temperature profile was used.
Archaeal amoA amplified from Rauischholzhausen agricultural soil (RH) and cloned into E.
coli Top10 competent cells using primers amo111F/amo643R (see II.6.2) was used as standard in dilution series (101-107 copies).
Table II.8-5: qPCR conditions for quantification of archaeal amoA
qPCR reaction mixture: Thermal profile:
Component Final conc. Volume Temperature program Cycles
2x SybrGreen Ready-Mix 1x 12.5 µl 95°C, 3 min 1
50 mM MgCl2 4 mM 2 µl 95°C, 15 s 45 (plate read)
50 µM amo196f 0.5 µM 0.5 µl 55°C, 45 s
50 µM amo277r 0.5 µM 0.5 µl 95°C, 60 s 1
20 µg/µl BSA 0.5 µg/µl 0.625 µl 55°C, 60 s 1
1:1000 FITC 0.25 µl 68.0 -97.7°Ca, 10 s 100 (melting curve)
DNA or cDNA template 1 µl 72°C, 10 min 1
Distilled water ad 25 µl 4°C, 5 min 1
a Melting curve: Set point temperature decreased after cycle 2 by 0.3°C for each cycle.
II.8.2.4 Quantification of bacterial amoA
For quantification of amoA genes and transcripts of Bacteria from DNA and cDNA SIP-fractions, and soil extracts, the following condition and temperature profile was used. Bacterial amoA amplified from Rauischholzhausen agricultural soil (RH) and cloned into E. coli Top10 competent cells using primers amoA-1F/amoA-2R (see II.6.2) was used as standard in dilution series (101-107 copies).
Table II.8-6: qPCR conditions for quantification of bacterial amoA
qPCR reaction mixture: Thermal profile:
Component Final conc. Volume Temperature program Cycles
2x SybrGreen Ready-Mix 1x 12.5 µl 94°C, 15 min 1
50 mM MgCl2 3 mM 1.5 µl 94°C, 45 s
50 µM amoA-1F 0.5 µM 0.25 µl 57°C, 30 s 40 (plate read) 50 µM amoA-2R 0.5 µM 0.25 µl 72°C, 3 min
20 µg/µl BSA 0.2 µg/µl 0.25 µl 83°C, 10 s
1:1000 FITC 0.25 µl 78.0 -97.8°Ca, 6 s 100 (melting curve)
DNA or cDNA template 1 µl 72°C,10 min 1
Distilled water ad 25 µl 4°C, 5 min 1
a Melting curve: Set point temperature decreased after cycle 2 by 0.2°C for each cycle.
II.8.2.5 Quantification of archaeal 16S rRNA genes and transcripts
For quantification of 16S rRNA genes and transcripts of Archaea from DNA and cDNA SIP-fractions, and soil extracts, the following condition and temperature profile was used. 16S rRNA gene amplified from Methanosarcina barkeri, amplified using primers A109f/A934b (see II.6.5), was provided by Melanie Klose and used as standard in dilution series (7.83x101 -7.83x107 copies).
Table II.8-7: qPCR conditions for quantification of archaeal 16S rRNA genes and transcripts
qPCR reaction mixture: Thermal profile:
Component Final conc. Volume Temperature program Cycles
2x SybrGreen Ready-Mix 1x 12.5 µl 94°C, 6 min 1
50 mM MgCl2 3 mM 1.5 µl 94°C, 35 s
50 µM A346aF 0.3 µM 0.15 µl 66°C, 30 s 45 (plate read) 50 µM A934b 0.3 µM 0.15 µl 72°C, 45 s
1:1000 FITC 0.25 µl 86.5°C, 10 s
DNA or cDNA template 1 µl 75.0 -94.8°Ca, 6 s 100 (melting curve)
Distilled water ad 25 µl 4°C, 5 min 1
a Melting curve: Set point temperature decreased after cycle 2 by 0.2°C for each cycle.
II.8.2.6 Quantification of bacterial 16S rRNA genes and transcripts
For quantification of 16S rRNA genes and transcripts of Bacteria from DNA and cDNA SIP-fractions, and soil extracts, the following condition and temperature profile was used. 16S rRNA gene amplified from Escherichia coli strain K12, amplified using primers Eub8F/Eub1392R (see II.6.5), was used as standard in dilution series (101-107 copies).
Table II.8-8: qPCR conditions for quantification of bacterial 16S rRNA genes and transcripts
qPCR reaction mixture: Thermal profile:
Component Final conc. Volume Temperature program Cycles
2x SybrGreen Ready-Mix 1x 12.5 µl 94°C, 8 min 1
50 mM MgCl2 4 mM 2 µl 94°C, 20 s
50 µM Ba519f 0.25 µM 0.125 µl 50°C, 20 s 35 (plate read) 50 µM Ba907r 0.25 µM 0.125 µl 72°C, 50 s
20 µg/µl BSA 0.2 µg/µl 0.25 µl 75.0 -94.8°Ca, 6 s 100 (melting curve)
1:1000 FITC 0.25 µl 4°C, 5 min 1
DNA or cDNA template 1 µl
Distilled water ad 25 µl
a Melting curve: Set point temperature decreased after cycle 2 by 0.2°C for each cycle.